pocketgull.app

{
  "name": "generate_medical_summary",
  "kind": "act",
  "impl": "imperative",
  "description": "Generates a medical summary for the current patient based on the provided clinical notes and current patient data.",
  "inputSchema": {
    "type": "object",
    "properties": {}
  },
  "page": "/"
}

{
  "name": "translate_clinical_text",
  "kind": "act",
  "impl": "imperative",
  "description": "Translates a clinical text to a specific reading level (e.g. simplified, child, dyslexia).",
  "inputSchema": {
    "type": "object",
    "properties": {
      "text": {
        "type": "string",
        "description": "The clinical text to translate."
      },
      "targetLevel": {
        "type": "string",
        "enum": [
          "simplified",
          "child",
          "dyslexia"
        ],
        "description": "The target reading level."
      }
    },
    "required": [
      "text",
      "targetLevel"
    ]
  },
  "page": "/"
}

{
  "name": "get_current_patient_data",
  "kind": "answer",
  "impl": "imperative",
  "description": "Retrieves the current patient data context being viewed in the application.",
  "inputSchema": {
    "type": "object",
    "properties": {}
  },
  "page": "/"
}

{
  "name": "navigate_to_body_part",
  "kind": "act",
  "impl": "imperative",
  "description": "Navigates the UI to focus on a specific body part and opens the analysis tab.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "partId": {
        "type": "string",
        "description": "The ID of the body part to navigate to (e.g., \"head\", \"right_knee\")."
      }
    },
    "required": [
      "partId"
    ]
  },
  "page": "/"
}

{
  "name": "inject_clinical_note",
  "kind": "act",
  "impl": "imperative",
  "description": "Injects structured clinical data (a note) for a specific body part.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "partId": {
        "type": "string",
        "description": "The ID of the body part (e.g., \"right_knee\")."
      },
      "painLevel": {
        "type": "number",
        "description": "Pain level from 0 to 10."
      },
      "description": {
        "type": "string",
        "description": "Clinical observations or description of the issue."
      },
      "recommendation": {
        "type": "string",
        "description": "Recommended treatments or next steps."
      }
    },
    "required": [
      "partId",
      "painLevel",
      "description"
    ]
  },
  "page": "/"
}

{
  "name": "load_research_url",
  "kind": "act",
  "impl": "imperative",
  "description": "Loads a external web URL or research document in the embedded research frame viewer.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "url": {
        "type": "string",
        "description": "The URL to load."
      }
    },
    "required": [
      "url"
    ]
  },
  "page": "/"
}

{
  "name": "add_research_bookmark",
  "kind": "act",
  "impl": "imperative",
  "description": "Pre-stages a relevant literature link in the patient's bookmarks.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "title": {
        "type": "string",
        "description": "The title of the bookmark."
      },
      "url": {
        "type": "string",
        "description": "The URL of the bookmark."
      },
      "authors": {
        "type": "string",
        "description": "The authors of the literature."
      },
      "doi": {
        "type": "string",
        "description": "The DOI of the literature."
      },
      "isPeerReviewed": {
        "type": "boolean",
        "description": "Whether the literature is peer-reviewed."
      },
      "cited": {
        "type": "boolean",
        "description": "Whether to include in summary references."
      }
    },
    "required": [
      "title",
      "url"
    ]
  },
  "page": "/"
}

{
  "name": "export_patient_csv_telemetry",
  "kind": "act",
  "impl": "imperative",
  "description": "Exports the active patient vital signs, biometric sensors, clinical assessment scores (PHQ-9, GAD-7, Y-BOCS, KSS), and telemetry metrics as an RFC 4180 CSV file.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "downloadFile": {
        "type": "boolean",
        "description": "Whether to trigger a client-side browser file download."
      }
    }
  },
  "page": "/"
}

{
  "name": "export_patient_hl7v2_message",
  "kind": "act",
  "impl": "imperative",
  "description": "Exports an HL7 v2.5.1 ER7 (pipe-delimited) ORU^R01 observation message containing patient clinical observations, vitals, and LOINC codes for legacy hospital EHR systems.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "downloadFile": {
        "type": "boolean",
        "description": "Whether to trigger a client-side browser file download."
      }
    }
  },
  "page": "/"
}

{
  "name": "convert_fhir_r7_to_r4",
  "kind": "act",
  "impl": "imperative",
  "description": "Converts a FHIR R7 Horizon continuous biophysics & transgenerational stream bundle into a standard statutory FHIR R4.0.1 US Core collection bundle with lossless encapsulation.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "r7BundleJson": {
        "type": "string",
        "description": "Optional JSON string of an IFhir7Bundle. If omitted, uses current patient live R7 bundle."
      }
    }
  },
  "page": "/"
}

{
  "name": "convert_fhir_r4_to_r7",
  "kind": "act",
  "impl": "imperative",
  "description": "Up-converts or round-trip restores a standard FHIR R4 bundle back into a FHIR R7 Horizon continuous biophysics stream bundle.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "r4BundleJson": {
        "type": "string",
        "description": "JSON string of the FHIR R4 Bundle to convert."
      }
    },
    "required": [
      "r4BundleJson"
    ]
  },
  "page": "/"
}

{
  "name": "convert_hl7_er7_to_fhir_r4",
  "kind": "act",
  "impl": "imperative",
  "description": "Parses and converts a legacy hospital HL7 v2.5.1 ER7 pipe-delimited message (ORU^R01) into a modern FHIR R4.0.1 Bundle.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "er7Message": {
        "type": "string",
        "description": "Raw HL7 v2.5.1 ER7 pipe-delimited text."
      }
    },
    "required": [
      "er7Message"
    ]
  },
  "page": "/"
}

{
  "name": "convert_fhir_r4_to_hl7_er7",
  "kind": "act",
  "impl": "imperative",
  "description": "Converts a modern FHIR R4.0.1 Bundle into a legacy hospital HL7 v2.5.1 ER7 pipe-delimited message (ORU^R01).",
  "inputSchema": {
    "type": "object",
    "properties": {
      "r4BundleJson": {
        "type": "string",
        "description": "JSON string of the FHIR R4 Bundle."
      }
    },
    "required": [
      "r4BundleJson"
    ]
  },
  "page": "/"
}

{
  "name": "purge_transient_patient_state",
  "kind": "act",
  "impl": "imperative",
  "description": "Purges all active patient state, transient in-memory signals, and local storage caches to enforce strict anti-surveillance privacy hygiene.",
  "inputSchema": {
    "type": "object",
    "properties": {}
  },
  "page": "/"
}

{
  "name": "toggle_ephemeral_privacy_mode",
  "kind": "act",
  "impl": "imperative",
  "description": "Toggles strict local edge privacy mode (enabling/disabling external network telemetry egress).",
  "inputSchema": {
    "type": "object",
    "properties": {
      "enabled": {
        "type": "boolean",
        "description": "Whether to enable strict local edge privacy mode."
      }
    }
  },
  "page": "/"
}

{
  "name": "get_teledentistry_systemic_telemetry",
  "kind": "answer",
  "impl": "imperative",
  "description": "Retrieves 32-tooth FDI odontogram findings, Tooth Wear Index (TWI Grades 0-4), periodontal probing depth (PPD >= 4mm), bleeding on probing (BOP), and Systemic Inflammatory Burden Index (SIBI 0-100) cross-talk to cardiovascular risk & HbA1c trajectory.",
  "inputSchema": {
    "type": "object",
    "properties": {}
  },
  "page": "/"
}

{
  "name": "update_tooth_periodontal_status",
  "kind": "act",
  "impl": "imperative",
  "description": "Updates periodontal probing depth (mm), Bleeding on Probing (BOP), surface caries, or Smith & Knight Tooth Wear Index (TWI Grade 0-4) for a specific FDI tooth number (11-48).",
  "inputSchema": {
    "type": "object",
    "properties": {
      "fdiNumber": {
        "type": "number",
        "description": "The FDI tooth number (e.g. 16 for Maxillary Right 1st Molar)."
      },
      "probingDepthMm": {
        "type": "number",
        "description": "Periodontal probing depth in millimeters."
      },
      "hasBleedingOnProbing": {
        "type": "boolean",
        "description": "Whether bleeding on probing is present."
      },
      "twiGrade": {
        "type": "number",
        "description": "Smith & Knight Tooth Wear Index grade (0 to 4)."
      }
    },
    "required": [
      "fdiNumber"
    ]
  },
  "page": "/"
}

{
  "name": "export_patient_care_plan_fhir_r4",
  "kind": "act",
  "impl": "imperative",
  "description": "Exports the active patient care plan as a de-identified HIPAA §164.514 compliant FHIR R4 Bundle JSON payload.",
  "inputSchema": {
    "type": "object",
    "properties": {}
  },
  "page": "/"
}

{
  "name": "trigger_hybrid_fhir_dual_sync",
  "kind": "act",
  "impl": "imperative",
  "description": "Triggers hybrid dual-synchronization of de-identified FHIR R4 care plans across Google Cloud Healthcare API & AWS HealthLake.",
  "inputSchema": {
    "type": "object",
    "properties": {}
  },
  "page": "/"
}

{
  "name": "calculate_skeptical_falsifiability_score",
  "kind": "act",
  "impl": "imperative",
  "description": "Evaluates Popperian p-value null-hypothesis testing (H0), Cochrane Risk of Bias 2.0 (RoB 2) rating, and FDA 21 CFR §520(o) CDS compliance report for clinical recommendations.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "lensName": {
        "type": "string",
        "description": "The clinical lens scope (e.g. \"Summary Overview\", \"PhysioNet / RSNA 2026\")."
      },
      "sampleSize": {
        "type": "number",
        "description": "Sample size N for null hypothesis evaluation."
      }
    }
  },
  "page": "/"
}

{
  "name": "set_gemini_thinking_reasoning_budget",
  "kind": "act",
  "impl": "imperative",
  "description": "Dynamically configures Gemini 2.5 Thinking model reasoning token budgets (1024 summary, 4096 protocol, 8192 high acuity SIBI/RSNA).",
  "inputSchema": {
    "type": "object",
    "properties": {
      "thinkingBudget": {
        "type": "number",
        "description": "The reasoning token budget (e.g. 1024, 4096, 8192)."
      },
      "enabled": {
        "type": "boolean",
        "description": "Whether reasoning thinking process is enabled."
      }
    },
    "required": [
      "thinkingBudget"
    ]
  },
  "page": "/"
}

{
  "name": "analyze_systemic_inflammatory_burden",
  "kind": "act",
  "impl": "imperative",
  "description": "Calculates the Systemic Inflammatory Burden Index (SIBI) cross-talk score from CRP, Periodontal Probing Depth (PPD), and blood pressure.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "hsCrp": {
        "type": "number",
        "description": "Serum hs-CRP level in mg/L."
      },
      "ppd": {
        "type": "number",
        "description": "Max Periodontal Probing Depth in mm."
      },
      "sbp": {
        "type": "number",
        "description": "Systolic Blood Pressure in mmHg."
      }
    },
    "required": [
      "hsCrp",
      "ppd",
      "sbp"
    ]
  },
  "page": "/"
}

{
  "name": "assess_cochrane_risk_of_bias",
  "kind": "act",
  "impl": "imperative",
  "description": "Evaluates literature evidence citations for Cochrane RoB 2 study design biases across randomization and missing outcome data.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "studyTitle": {
        "type": "string",
        "description": "The title of the clinical trial or literature citation."
      },
      "randomization": {
        "type": "string",
        "enum": [
          "LOW",
          "SOME_CONCERNS",
          "HIGH"
        ],
        "description": "Randomization bias assessment."
      },
      "missingData": {
        "type": "string",
        "enum": [
          "LOW",
          "SOME_CONCERNS",
          "HIGH"
        ],
        "description": "Missing outcome data bias assessment."
      }
    },
    "required": [
      "studyTitle",
      "randomization",
      "missingData"
    ]
  },
  "page": "/"
}

{
  "name": "query_biophysical_substrate_params",
  "kind": "answer",
  "impl": "imperative",
  "description": "Returns 3D anatomical WebGL PBR surface and biophysical tissue parameters.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "tissueType": {
        "type": "string",
        "enum": [
          "bone",
          "skin",
          "vascular",
          "dental"
        ],
        "description": "Anatomical tissue type."
      }
    },
    "required": [
      "tissueType"
    ]
  },
  "page": "/"
}

{
  "name": "evaluate_irmaa_medicare_surcharge_and_ssa44_appeal",
  "kind": "act",
  "impl": "imperative",
  "description": "Calculates Medicare Part B and Part D IRMAA monthly surcharges, tax cliff buffer distance, and Social Security Form SSA-44 Life-Changing Event appeal eligibility.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "magi": {
        "type": "number",
        "description": "Modified Adjusted Gross Income (from 2 years prior or current estimate)"
      },
      "filingStatus": {
        "type": "string",
        "enum": [
          "single",
          "joint",
          "separate"
        ],
        "description": "Tax Filing Status"
      },
      "lifeChangingEvents": {
        "type": "array",
        "items": {
          "type": "string"
        },
        "description": "Qualifying events: WORK_STOPPAGE, WORK_REDUCTION, DEATH_OF_SPOUSE, MARRIAGE, DIVORCE_OR_ANNULMENT, INCOME_PROPERTY_LOSS, PENSION_PORTFOLIO_LOSS, EMPLOYER_SETTLEMENT"
      }
    },
    "required": [
      "magi"
    ]
  },
  "page": "/"
}

{
  "name": "evaluate_medicare_billing_and_gfe_eligibility",
  "kind": "act",
  "impl": "imperative",
  "description": "Evaluates Inflation Reduction Act $2,000 Part D prescription cap, MPPP monthly smoothing, RPM/CCM CPT compliance (CPT 99454/99457), No Surprises Act Good Faith Estimates, and IRS Section 501(r) Charity Care FPL eligibility.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "annualRxCost": {
        "type": "number",
        "description": "Annual out-of-pocket prescription medication cost"
      },
      "daysDeviceTransmitted": {
        "type": "number",
        "description": "Days of RPM physiological telemetry readings in 30-day period (16+ required)"
      },
      "clinicalMinutesLogged": {
        "type": "number",
        "description": "Minutes of clinical staff management time in month (20+ required)"
      },
      "annualIncome": {
        "type": "number",
        "description": "Patient household annual income in USD"
      },
      "householdSize": {
        "type": "number",
        "description": "Household size (default 1)"
      }
    },
    "required": [
      "annualRxCost",
      "annualIncome"
    ]
  },
  "page": "/"
}

{
  "name": "evaluate_hedis_quality_measures_and_care_gaps",
  "kind": "act",
  "impl": "imperative",
  "description": "Evaluates HEDIS quality measures (CBP, HBD, MAD, MAH, MAS, COL, EED), CMS 1-5 Star Ratings, triple-weighted medication adherence PDC percentages, and CMS Quality Bonus Payment (QBP) eligibility.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "systolicBp": {
        "type": "number",
        "description": "Systolic blood pressure in mmHg"
      },
      "diastolicBp": {
        "type": "number",
        "description": "Diastolic blood pressure in mmHg"
      },
      "hbA1c": {
        "type": "number",
        "description": "Hemoglobin A1c percentage (e.g. 7.2)"
      },
      "diabetesRefillDays": {
        "type": "number",
        "description": "Diabetes medication refill days in year"
      },
      "hypertensionRefillDays": {
        "type": "number",
        "description": "Hypertension/RAS medication refill days in year"
      },
      "statinRefillDays": {
        "type": "number",
        "description": "Statin medication refill days in year"
      },
      "hasColorectalScreening": {
        "type": "boolean",
        "description": "Whether colorectal screening is up to date"
      },
      "hasDiabeticEyeExam": {
        "type": "boolean",
        "description": "Whether diabetic retinal exam is complete"
      }
    }
  },
  "page": "/"
}

{
  "name": "submit_fhir_davinci_prior_authorization_claim",
  "kind": "transact",
  "impl": "imperative",
  "description": "Submits HL7 FHIR Da Vinci PAS (Prior Authorization Support) IG claim under CMS-0057-F mandate for real-time sub-second medical necessity prior-authorization approval.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "patientId": {
        "type": "string",
        "description": "Patient Identifier (e.g. p010)"
      },
      "payerId": {
        "type": "string",
        "description": "Payer Identifier (default PAYER-MEDICARE-001)"
      },
      "cptCode": {
        "type": "string",
        "description": "CPT Procedure Code (e.g. 70553 Brain MRI, 78607 DaTscan, 74177 Abdominal CT)"
      },
      "icd10DiagnosisCodes": {
        "type": "array",
        "items": {
          "type": "string"
        },
        "description": "ICD-10 Diagnosis Codes (e.g. G30.9, G20, C25.0)"
      },
      "clinicalDocumentationText": {
        "type": "string",
        "description": "Supporting clinical note text"
      }
    },
    "required": [
      "cptCode",
      "icd10DiagnosisCodes"
    ]
  },
  "page": "/"
}

{
  "name": "crosswalk_snomed_ct_to_icd10_and_cpt",
  "kind": "answer",
  "impl": "imperative",
  "description": "Cross-walks point-of-care SNOMED CT clinical terms (USCDI v4 mandate) to ICD-10-CM diagnosis codes, CPT procedure codes, LOINC lab identifiers, and RxNorm CUIs.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "snomedCode": {
        "type": "string",
        "description": "SNOMED CT Concept Code (e.g. 26929004 Alzheimer, 49049000 Parkinson, 372130007 Pancreatic Cancer, 38341003 Hypertension, 73211009 Diabetes)"
      }
    },
    "required": [
      "snomedCode"
    ]
  },
  "page": "/"
}

{
  "name": "analyze_webgpu_bio_signal_tremor_and_rppg",
  "kind": "act",
  "impl": "imperative",
  "description": "Executes 100% client-side WebGPU zero-egress tremor frequency spectrum analysis (3-6 Hz Parkinsonian vs 6-12 Hz Essential tremor) and rPPG Heart Rate Variability (HRV / RMSSD).",
  "inputSchema": {
    "type": "object",
    "properties": {
      "displacementsMm": {
        "type": "array",
        "items": {
          "type": "number"
        },
        "description": "Spatial displacement array in millimeters (30 fps sample rate)"
      },
      "luminescenceSignal": {
        "type": "array",
        "items": {
          "type": "number"
        },
        "description": "Skin luminescence intensity array for rPPG heart rate extraction"
      }
    }
  },
  "page": "/"
}

{
  "name": "calculate_clinical_game_theory_adherence_incentives",
  "kind": "act",
  "impl": "imperative",
  "description": "Calculates Stackelberg / Nash equilibrium for medication adherence rebate subsidies and avoided hospitalization savings.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "patientId": {
        "type": "string",
        "description": "Patient ID (e.g. p010)"
      },
      "conditionName": {
        "type": "string",
        "description": "Condition name (e.g. Parkinson disease)"
      },
      "annualCopayCostUsd": {
        "type": "number",
        "description": "Annual patient co-pay cost in USD"
      },
      "estAnnualHospitalizationRiskUsd": {
        "type": "number",
        "description": "Estimated avoided inpatient hospitalization cost in USD"
      }
    },
    "required": [
      "annualCopayCostUsd",
      "estAnnualHospitalizationRiskUsd"
    ]
  },
  "page": "/"
}

{
  "name": "prescribe_joy_and_playful_flourishing",
  "kind": "act",
  "impl": "imperative",
  "description": "Prescribes micro-joy and micro-play activities (acoustic neuro-rhythm entrainment, botanical foraging, origami, storytelling, laughter yoga) and calculates PERMA+ playfulness scorecards.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "patientId": {
        "type": "string",
        "description": "Patient ID (e.g. p010)"
      }
    }
  },
  "page": "/"
}

{
  "name": "match_clinical_trials_for_patient_conditions",
  "kind": "act",
  "impl": "imperative",
  "description": "Queries ClinicalTrials.gov API v2 for active recruiting clinical trials matching patient conditions, returning Phase I-IV studies and eligibility match scores.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "conditionName": {
        "type": "string",
        "description": "Condition name (e.g. Parkinson Disease, Alzheimer Disease, Glioblastoma)"
      },
      "recruitingOnly": {
        "type": "boolean",
        "description": "Filter only actively recruiting trials"
      }
    },
    "required": [
      "conditionName"
    ]
  },
  "page": "/"
}

{
  "name": "initiate_smart_on_fhir_ehr_launch",
  "kind": "act",
  "impl": "imperative",
  "description": "Generates SMART-on-FHIR OAuth2 authorization launch URL with PKCE S256 challenge for embedded Epic, Cerner, and AthenaHealth EHR launches.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "vendor": {
        "type": "string",
        "enum": [
          "EPIC",
          "CERNER",
          "ATHENAHEALTH",
          "GENERIC_FHIR"
        ],
        "description": "Target EHR vendor"
      },
      "fhirBaseUrl": {
        "type": "string",
        "description": "FHIR R4 Server Base URL"
      },
      "clientId": {
        "type": "string",
        "description": "SMART App Client ID"
      },
      "launchToken": {
        "type": "string",
        "description": "EHR Launch Context Token"
      }
    },
    "required": [
      "vendor"
    ]
  },
  "page": "/"
}

{
  "name": "calculate_medicare_irmaa_and_ssa44_appeals",
  "kind": "act",
  "impl": "imperative",
  "description": "Calculates 2026 Medicare IRMAA Part B/D income surcharges based on MAGI and determines eligibility for SSA-44 Life-Changing Event appeals.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "magiUsd": {
        "type": "number",
        "description": "Modified Adjusted Gross Income in USD"
      },
      "filingStatus": {
        "type": "string",
        "enum": [
          "single",
          "joint",
          "separate"
        ],
        "description": "Tax filing status"
      },
      "lifeChangingEvent": {
        "type": "string",
        "enum": [
          "WORK_STOPPAGE",
          "WORK_REDUCTION",
          "MARRIAGE",
          "DIVORCE_OR_ANNULMENT",
          "INCOME_PROPERTY_LOSS"
        ],
        "description": "SSA-44 Life-Changing Event"
      }
    },
    "required": [
      "magiUsd"
    ]
  },
  "page": "/"
}

{
  "name": "render_webgpu_3d_organ_digital_twin",
  "kind": "act",
  "impl": "imperative",
  "description": "Calculates real-time WebGPU 3D organ digital twin mesh deformation, perfusion rates, and WGSL compute shader parameters.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "organ": {
        "type": "string",
        "enum": [
          "HEART",
          "LUNGS",
          "LIVER",
          "KIDNEYS",
          "BRAIN"
        ],
        "description": "Target organ"
      },
      "heartRateBpm": {
        "type": "number",
        "description": "Heart rate in BPM"
      },
      "spo2Percent": {
        "type": "number",
        "description": "Blood oxygen saturation percentage (70-100%)"
      }
    },
    "required": [
      "organ"
    ]
  },
  "page": "/"
}

{
  "name": "guide_user_onboarding_walkthrough",
  "kind": "act",
  "impl": "imperative",
  "description": "Starts or advances interactive feature onboarding walkthrough tours tailored for PATIENT, CLINICIAN, or RESEARCHER personas.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "action": {
        "type": "string",
        "enum": [
          "START",
          "NEXT",
          "PREVIOUS",
          "STOP"
        ],
        "description": "Tour action"
      },
      "persona": {
        "type": "string",
        "enum": [
          "PATIENT",
          "CLINICIAN",
          "RESEARCHER",
          "ALL"
        ],
        "description": "Target user persona"
      }
    },
    "required": [
      "action"
    ]
  },
  "page": "/"
}

{
  "name": "navigate_user_way_back_home",
  "kind": "act",
  "impl": "imperative",
  "description": "Resets user active shell navigation to primary clinical chart, closes all open modal overlays, and restores home view state.",
  "inputSchema": {
    "type": "object",
    "properties": {},
    "required": []
  },
  "page": "/"
}

{
  "name": "retrieve_helpful_community_and_clinical_lists",
  "kind": "act",
  "impl": "imperative",
  "description": "Retrieves curated quick-reference lists for 24/7 emergency hotlines (988, Poison, Vets), free 50-state statutory living wills, HEDIS quality benchmarks, and SSA-44 appeal checklists.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "category": {
        "type": "string",
        "enum": [
          "EMERGENCY_HOTLINES",
          "PATIENT_RIGHTS_LIVING_WILLS",
          "CLINICAL_CHECKLISTS",
          "MEDICARE_FINANCIAL_RESOURCES",
          "ALL"
        ],
        "description": "Target list category"
      }
    },
    "required": []
  },
  "page": "/"
}

{
  "name": "translate_clinical_care_plan_multilingual",
  "kind": "act",
  "impl": "imperative",
  "description": "Translates clinical care plans into plain-language multilingual summaries across 10 global languages (English, Spanish, Mandarin, Hindi, Arabic, Tagalog, French, Swahili, German, Japanese).",
  "inputSchema": {
    "type": "object",
    "properties": {
      "text": {
        "type": "string",
        "description": "Clinical recommendation text"
      },
      "targetLanguageCode": {
        "type": "string",
        "enum": [
          "en",
          "es",
          "zh",
          "hi",
          "ar",
          "tl",
          "fr",
          "sw",
          "de",
          "ja"
        ],
        "description": "Target language code"
      }
    },
    "required": [
      "text"
    ]
  },
  "page": "/"
}

{
  "name": "calculate_who_cdc_health_equity_index",
  "kind": "act",
  "impl": "imperative",
  "description": "Evaluates WHO GPW 14 and CDC 2025-2030 Global Health Equity Index, SDOH PRAPARE risk vectors (housing, food, transport), and climate-health AQI vulnerability metrics.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "sdoh": {
        "type": "object",
        "properties": {
          "housingInsecurity": {
            "type": "boolean"
          },
          "foodInsecurity": {
            "type": "boolean"
          },
          "transportationBarrier": {
            "type": "boolean"
          },
          "utilityInsecurity": {
            "type": "boolean"
          },
          "digitalLiteracyBarrier": {
            "type": "boolean"
          }
        }
      },
      "climate": {
        "type": "object",
        "properties": {
          "airQualityIndex": {
            "type": "number"
          },
          "pm25MicrogramsM3": {
            "type": "number"
          },
          "extremeHeatRiskDaysYear": {
            "type": "number"
          }
        }
      }
    },
    "required": []
  },
  "page": "/"
}

{
  "name": "recommend_sustainability_and_eco_health_actions",
  "kind": "act",
  "impl": "imperative",
  "description": "Generates green computing, IEEE PES energy reduction, EAT-Lancet planetary health nutrition, active transit, and circular waste sustainability recommendations.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "category": {
        "type": "string",
        "enum": [
          "COMPUTE_ENERGY",
          "PLANETARY_DIET",
          "ACTIVE_TRANSIT",
          "CIRCULAR_WASTE_REDUCTION",
          "JOYFUL_ECO_EXPERIENCE",
          "ALL"
        ],
        "description": "Target eco recommendation category"
      }
    },
    "required": []
  },
  "page": "/"
}

{
  "name": "localize_community_eco_health_hubs",
  "kind": "act",
  "impl": "imperative",
  "description": "Finds local farmers markets, community gardens, Shinrin-yoku forest bathing parks, greenways, and seed sharing libraries by geo-location.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "hubType": {
        "type": "string",
        "enum": [
          "FARMERS_MARKET",
          "COMMUNITY_GARDEN",
          "FOREST_PARK",
          "GREENWAY_BIKE_PATH",
          "SEED_TOOL_LIBRARY",
          "ALL"
        ],
        "description": "Target eco hub type filter"
      }
    },
    "required": []
  },
  "page": "/"
}

{
  "name": "export_complete_fhir_r4_health_sovereignty_bundle",
  "kind": "act",
  "impl": "imperative",
  "description": "Exports a complete HIPAA-compliant FHIR R4 Bundle containing patient demographic resources, observations, vitals, clinical assessments, and tri-paradigm care plans.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "format": {
        "type": "string",
        "enum": [
          "JSON",
          "COMPACT_JSON",
          "SUMMARY"
        ],
        "description": "Export bundle payload format"
      }
    },
    "required": []
  },
  "page": "/"
}

{
  "name": "open_zen_sanctuary",
  "kind": "act",
  "impl": "imperative",
  "description": "Activates the 1-click Zen Sanctuary Mode with 432Hz Tibetan singing bowl chime, 4-7-8 vagal breath pacer, and Kintsugi gold vein healing illumination.",
  "inputSchema": {
    "type": "object",
    "properties": {},
    "additionalProperties": false
  },
  "page": "/"
}

{
  "name": "get_healing_postcards",
  "kind": "answer",
  "impl": "imperative",
  "description": "Retrieves quiet, anonymous peer encouragement postcards from the pier with recovery notes and community affirmations.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "limit": {
        "type": "number",
        "description": "Maximum number of postcards to retrieve"
      }
    },
    "additionalProperties": false
  },
  "page": "/"
}

{
  "name": "evaluate_ssa_disability_and_blue_book_listings",
  "kind": "transact",
  "impl": "imperative",
  "description": "Evaluates patient eligibility under Social Security Administration (SSA) Blue Book 20 CFR Part 404 App 1, screens Compassionate Allowances (CAL), and synthesizes Residual Functional Capacity (RFC).",
  "inputSchema": {
    "type": "object",
    "properties": {
      "claimantAge": {
        "type": "number",
        "description": "Claimant age in years"
      },
      "primaryDiagnosis": {
        "type": "string",
        "description": "Primary impairment diagnosis"
      },
      "secondaryDiagnosis": {
        "type": "string",
        "description": "Secondary medical condition"
      },
      "ejectionFractionPercent": {
        "type": "number",
        "description": "Left ventricular ejection fraction percentage"
      },
      "fev1Liters": {
        "type": "number",
        "description": "Pulmonary FEV1 in liters"
      },
      "isAmbulatoryAssistanceRequired": {
        "type": "boolean",
        "description": "Whether bilateral upper-limb ambulatory device is required"
      }
    },
    "additionalProperties": false
  },
  "page": "/"
}

{
  "name": "get_jurisdictional_compliance_and_regulatory_matrix",
  "kind": "answer",
  "impl": "imperative",
  "description": "Retrieves data privacy statutes, clinical AI device classifications (EU AI Act, FDA, MHRA, PMDA, CDSCO), EHR standards, and mandatory consent requirements for US states (CA, WA, IL, NY, TX) and international jurisdictions (EU, UK, Canada, Australia, Japan, India).",
  "inputSchema": {
    "type": "object",
    "properties": {
      "countryCode": {
        "type": "string",
        "description": "ISO 3166-1 alpha-2 country code (e.g. US, EU, GB, CA, AU, JP, IN)"
      },
      "stateCode": {
        "type": "string",
        "description": "US State code if country is US (e.g. CA, WA, IL, NY, TX)"
      }
    },
    "additionalProperties": false
  },
  "page": "/"
}

{
  "name": "query_mandiant_threat_intelligence_and_defense",
  "kind": "answer",
  "impl": "imperative",
  "description": "Queries Google Mandiant threat actor profiles (UNC2596, FIN12, APT41, UNC3944), MITRE ATLAS AI attack vectors, HHS 405(d) HICP alignment, and DFIR incident containment telemetry.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "threatActorId": {
        "type": "string",
        "description": "Specific actor ID to query (e.g. MND-UNC2596, MND-FIN12, MND-APT41)"
      },
      "triggerEmergencyContainment": {
        "type": "boolean",
        "description": "Set true to simulate emergency zero-trust containment"
      }
    },
    "additionalProperties": false
  },
  "page": "/"
}

{
  "name": "administer_clinical_mandarinate_exam",
  "kind": "act",
  "impl": "imperative",
  "description": "Administers standardized meritocratic clinical OSCE examinations (Cardiology, Neurology, Integrative Pharma), evaluating candidate diagnostic accuracy, contraindication harm avoidance, and multi-paradigm balance.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "caseId": {
        "type": "string",
        "description": "Exam vignette case ID (e.g. CASE-CARDIO-01, CASE-NEURO-02, CASE-INTEGRATIVE-03)"
      },
      "selectedPrimaryDiagnosis": {
        "type": "string",
        "description": "Primary diagnostic conclusion"
      },
      "differentialDiagnoses": {
        "type": "array",
        "items": {
          "type": "string"
        },
        "description": "Differential diagnostic considerations"
      },
      "identifiedContraindications": {
        "type": "array",
        "items": {
          "type": "string"
        },
        "description": "Safety contraindications flagged"
      }
    },
    "additionalProperties": false
  },
  "page": "/"
}

{
  "name": "generate_ai_branding_package",
  "kind": "act",
  "impl": "imperative",
  "description": "Generates an AI branding package including color palettes, typography, and marketing assets.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "brandName": {
        "type": "string",
        "description": "Name of the brand or enterprise"
      },
      "industry": {
        "type": "string",
        "description": "Industry or clinical domain"
      },
      "style": {
        "type": "string",
        "description": "Visual style (e.g. Modern, Minimal, Warm, Clinical)"
      },
      "primaryHex": {
        "type": "string",
        "description": "Optional primary brand hex color"
      }
    },
    "required": [
      "brandName"
    ]
  },
  "page": "/"
}

{
  "name": "pocketgull_trigger_federated_round",
  "kind": "act",
  "impl": "imperative",
  "description": "Executes a client-side Privacy-Preserving Federated Learning round with Gaussian Differential Privacy (ε=2.0, δ=1e-5) and zero-sum Secure Aggregation (SecAgg) across clinical swarm nodes.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "roundReason": {
        "type": "string",
        "description": "Optional clinical rationale or trigger motive for the federated gradient update round."
      }
    }
  },
  "page": "/"
}

{
  "name": "pocketgull_verify_evidence_attestation",
  "kind": "act",
  "impl": "imperative",
  "description": "Generates and cryptographically verifies a SHA-256 Merkle inclusion proof for a clinical evidence trial node in the Open Evidence Commons.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "nodeId": {
        "type": "string",
        "description": "Unique identifier of the clinical evidence node (e.g. ev-sprint-2015, ev-predimed-2018, ev-empa-reg-2015)."
      }
    },
    "required": [
      "nodeId"
    ]
  },
  "page": "/"
}

{
  "name": "pocketgull_query_evidence_commons",
  "kind": "act",
  "impl": "imperative",
  "description": "Queries community-attested clinical evidence trials and consensus scores in the Open Evidence Commons by ICD-10/SNOMED condition code or keyword.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "conditionOrQuery": {
        "type": "string",
        "description": "Condition name, ICD-10 code (e.g. I10, E11.9), or search keyword."
      }
    }
  },
  "page": "/"
}

{
  "name": "get_staked_patent_claims_summary",
  "kind": "answer",
  "impl": "imperative",
  "description": "Returns a summary of PocketGull 200 formal staked patent claims across 10 core invention clusters and 7 statutory copyright & invention clauses.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "clusterId": {
        "type": "string",
        "description": "Optional specific cluster ID (e.g., cluster-1-popperian-epistemology, cluster-2-webgpu-bio-signals)."
      }
    }
  },
  "page": "/"
}

{
  "name": "get_uspto_provisional_patent_binder",
  "kind": "answer",
  "impl": "imperative",
  "description": "Returns the full USPTO provisional patent application binder for \"System and Method for Tri-Paradigm Consilience and Finite-Sample Conformal Clinical Intervals with Epistemic Abstention\" (Docket PG-PAT-2026-CONF-001) including abstract, prior art demarcation against Epic Sepsis Model, 20 formal claims (system, method, CRM), and ASCII figures.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "includeFullMarkdown": {
        "type": "boolean",
        "description": "Whether to include the entire raw markdown specification."
      },
      "claimType": {
        "type": "string",
        "enum": [
          "All",
          "System",
          "Method",
          "CRM"
        ],
        "description": "Filter claims by statutory category."
      }
    }
  },
  "page": "/"
}

{
  "name": "evaluate_protac_hook_effect",
  "kind": "act",
  "impl": "imperative",
  "description": "Evaluates polypharmacy and supplement regimens against the 3-body PROTAC Hook Effect bell curve and competitive CYP auto-inhibition limits.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "totalSupplementsCount": {
        "type": "number",
        "description": "Total number of active dietary supplements and nutraceuticals in the regimen (default: 8)"
      },
      "cyp3a4SubstrateCount": {
        "type": "number",
        "description": "Number of compounds sharing the hepatic CYP3A4 metabolic pathway (default: 3)"
      },
      "optimalDoseCopt": {
        "type": "number",
        "description": "Optimal maximum non-inhibitory supplement count C_opt (default: 5)"
      }
    }
  },
  "page": "/"
}

{
  "name": "evaluate_llps_phase_boundary",
  "kind": "act",
  "impl": "imperative",
  "description": "Evaluates aggregate clearing claims against Cahn-Hilliard thermodynamic spinodal phase boundaries and Flory-Huggins interaction parameters.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "moleculeName": {
        "type": "string",
        "description": "Name of the therapeutic molecule or botanical extract (e.g. \"Curcumin Liposomal + Resveratrol\")"
      },
      "claimedAggregateTarget": {
        "type": "string",
        "description": "Claimed biological aggregate target (e.g. \"Amyloid-β & Hyperphosphorylated Tau Fibrils\")"
      },
      "hydrophobicFloryChi": {
        "type": "number",
        "description": "Flory-Huggins interaction parameter χ (critical spinodal threshold >= 2.0, default: 1.42)"
      },
      "freeEnergyDeltaFMix": {
        "type": "number",
        "description": "Mixing free energy ΔF_mix in normalized thermal units (must be < 0 for spontaneous phase separation, default: 0.12)"
      }
    }
  },
  "page": "/"
}

{
  "name": "evaluate_quantum_thermal_noise",
  "kind": "act",
  "impl": "imperative",
  "description": "Falsifies bio-resonance, scalar energy, or EMF frequency claims against the physiological thermal collision dissipation floor (k_B T = 4.28e-21 J at 37°C).",
  "inputSchema": {
    "type": "object",
    "properties": {
      "deviceOrClaimName": {
        "type": "string",
        "description": "Name of the bio-resonance device or therapeutic claim (default: \"Scalar Bio-Resonance Frequency Harmonizer\")"
      },
      "claimedFieldTesla": {
        "type": "number",
        "description": "Claimed magnetic field strength in Tesla (default: 1e-6)"
      },
      "frequencyHz": {
        "type": "number",
        "description": "Claimed operating electromagnetic frequency in Hertz (default: 7.83)"
      }
    }
  },
  "page": "/"
}

{
  "name": "simulate_cahn_hilliard_llps",
  "kind": "act",
  "impl": "imperative",
  "description": "Simulates 2D Cahn-Hilliard Phase Field liquid-liquid phase separation (LLPS) PDE for membraneless organelle condensation and protein aggregation kinetics.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "timesteps": {
        "type": "number",
        "description": "Number of finite difference PDE integration timesteps (default: 50)"
      },
      "mobility": {
        "type": "number",
        "description": "Molecular mobility M in the non-conserved/conserved kinetic equation (default: 1.0)"
      },
      "gradientEnergy": {
        "type": "number",
        "description": "Interfacial gradient energy penalty kappa (default: 0.5)"
      },
      "meanConcentration": {
        "type": "number",
        "description": "Initial average phase volume fraction c_0 [-1.0 to 1.0] (default: 0.0)"
      }
    }
  },
  "page": "/"
}

{
  "name": "evaluate_cannabinoid_microtubule_stabilization",
  "kind": "act",
  "impl": "imperative",
  "description": "Evaluates phytocannabinoid (THC, CBD, CBG, CBN, BCP) and endocannabinoid modulation of cytoskeletal microtubule stability, Lys40 acetylation, and axonal transport velocity.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "compound": {
        "type": "string",
        "enum": [
          "THC",
          "CBD",
          "CBG",
          "CBN",
          "CARYOPHYLLENE",
          "ANANDAMIDE_2AG"
        ],
        "description": "Cannabinoid compound identifier (default: \"CBD\")"
      },
      "doseMicroMolar": {
        "type": "number",
        "description": "Dose concentration in micromolar (0.01 - 20 μM, default: 2.5)"
      },
      "baselineCatastrophePerMin": {
        "type": "number",
        "description": "Baseline unperturbed microtubule catastrophe frequency per minute (default: 0.85)"
      }
    }
  },
  "page": "/"
}

{
  "name": "simulate_chromatin_loop_extrusion",
  "kind": "act",
  "impl": "imperative",
  "description": "Simulates 3D chromatin polymer dynamics, active loop extrusion by Cohesin motors, and generates the 2D Hi-C contact probability matrix across CTCF boundary barriers.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "locusLengthKb": {
        "type": "number",
        "description": "Genomic locus length in kilobases (default: 2000)"
      },
      "cohesinSpeedKbPerSec": {
        "type": "number",
        "description": "Cohesin extrusion velocity in kb/s (default: 1.0)"
      },
      "ctcfPermeability": {
        "type": "number",
        "description": "CTCF boundary permeability (0.0 strict barrier to 1.0 leaky, default: 0.20)"
      }
    }
  },
  "page": "/"
}

{
  "name": "compute_transcriptional_condensate_phase",
  "kind": "act",
  "impl": "imperative",
  "description": "Calculates liquid-liquid phase separation (LLPS) boundaries, droplet radius, surface tension, and transcriptional burst frequencies for multi-valent IDR condensates (MED1, BRD4, RNA Pol II) at super-enhancers.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "med1ConcentrationUm": {
        "type": "number",
        "description": "MED1 coactivator concentration in micromolar (default: 4.5)"
      },
      "brd4ConcentrationUm": {
        "type": "number",
        "description": "BRD4 acetyl-reader concentration in micromolar (default: 3.2)"
      },
      "rnaPolIiConcentrationUm": {
        "type": "number",
        "description": "RNA Polymerase II concentration in micromolar (default: 1.8)"
      },
      "chromatinDensityKbPerUm3": {
        "type": "number",
        "description": "Local chromatin density in kb/μm3 (default: 120.0)"
      }
    }
  },
  "page": "/"
}

{
  "name": "evaluate_crispr_r_loop_energetics",
  "kind": "act",
  "impl": "imperative",
  "description": "Evaluates base-by-base thermodynamic free energy (ΔG) reaction coordinates, DNA unwinding torsional torque, seed-region mismatch penalties, and kinetic proofreading for CRISPR-Cas9/Cas12 off-target proofing.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "guideRnaSeq": {
        "type": "string",
        "description": "20-nt Guide RNA spacer sequence (default: \"GACUUGACAGUCUACGAUCG\")"
      },
      "targetDnaSeq": {
        "type": "string",
        "description": "20-nt Target DNA protospacer sequence (default: \"GACTTGACAGTCTACGATCG\")"
      },
      "pamMotif": {
        "type": "string",
        "description": "PAM motif sequence (default: \"NGG\")"
      },
      "superhelicalDensitySigma": {
        "type": "number",
        "description": "DNA superhelical topological density sigma (default: -0.06)"
      }
    }
  },
  "page": "/"
}

{
  "name": "simulate_nucleosome_force_spectroscopy",
  "kind": "act",
  "impl": "imperative",
  "description": "Simulates optical tweezers force spectroscopy (0-35 pN) of nucleosome unwrapping, outer-turn vs inner-core rupture forces, and epigenetic electrostatic charge modifications (H3K27ac vs H3K27me3).",
  "inputSchema": {
    "type": "object",
    "properties": {
      "epigeneticState": {
        "type": "string",
        "enum": [
          "UNMODIFIED_CANONICAL",
          "HYPERACETYLATED_H3K27AC",
          "POLYCOMB_H3K27ME3",
          "HETEROCHROMATIN_H3K9ME3"
        ],
        "description": "Histone epigenetic modification state (default: \"HYPERACETYLATED_H3K27AC\")"
      },
      "ionicStrengthMm": {
        "type": "number",
        "description": "Monovalent salt ionic strength in mM (default: 150)"
      }
    }
  },
  "page": "/"
}

{
  "name": "evaluate_linc_mechanotransduction",
  "kind": "act",
  "impl": "imperative",
  "description": "Models mechanical force transmission from extracellular matrix (ECM) stiffness through SUN/Nesprin LINC bridges to the nuclear envelope, predicting YAP/TAZ nuclear translocation ratios.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "ecmStiffnessKPa": {
        "type": "number",
        "description": "Extracellular matrix stiffness in kPa (0.5 - 40 kPa, default: 8.5)"
      },
      "actinTensionNn": {
        "type": "number",
        "description": "Retrograde actin stress fiber tension in nN (default: 2.4)"
      }
    }
  },
  "page": "/"
}

{
  "name": "export_scaffold_geometry",
  "kind": "act",
  "impl": "imperative",
  "description": "Exports physical 3D bioprinter CAD geometries (STL, glTF 2.0), acoustic phased-array phase maps, and G-code profiles for the acoustically levitated regenerative healing scaffold.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "lesionRadiusX": {
        "type": "number",
        "description": "Semi-major lesion axis in mm (default 12.0)"
      },
      "lesionRadiusY": {
        "type": "number",
        "description": "Semi-minor lesion axis in mm (default 9.5)"
      },
      "lesionRadiusZ": {
        "type": "number",
        "description": "Axial lesion depth in mm (default 4.0)"
      },
      "porosityPercent": {
        "type": "number",
        "description": "Scaffold porosity percentage 0-100 (default 78.0)"
      },
      "targetOrgan": {
        "type": "string",
        "description": "Target organ or tissue defect (e.g. \"Lumbar Disc Herniation\", \"Articular Cartilage\")"
      },
      "format": {
        "type": "string",
        "enum": [
          "stl_ascii",
          "stl_binary",
          "gltf",
          "acoustic_phase_map",
          "gcode",
          "all"
        ],
        "description": "Export payload format (default \"all\")"
      }
    }
  },
  "page": "/"
}

{
  "name": "configure_optical_therapy",
  "kind": "act",
  "impl": "imperative",
  "description": "Configures positive optical innovations and photobiomodulation therapies: 670nm deep red mitochondrial retinal PBM (UCL Cytochrome c oxidase activation), OKN/VOR vestibular gratings, CIE S 026 melanopic ipRGC circadian lux tuning, and dichoptic interocular optical beats.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "mode": {
        "type": "string",
        "enum": [
          "photobiomodulation-670nm",
          "okn-vor-grating",
          "melanopic-iprgc-circadian",
          "dichoptic-optical-beat",
          "ganzfeld-orp-reticle"
        ],
        "description": "The target optical therapy mode."
      },
      "pbmAction": {
        "type": "string",
        "enum": [
          "start",
          "pause",
          "reset"
        ],
        "description": "Action for 670nm photobiomodulation session timer."
      },
      "circadianPhase": {
        "type": "string",
        "enum": [
          "dawn-alert",
          "noon-zenith",
          "dusk-depletion",
          "night-ruby"
        ],
        "description": "CIE S 026 melanopic circadian phase to engage."
      },
      "oknDirection": {
        "type": "string",
        "enum": [
          "left-to-right",
          "right-to-left",
          "bilateral-respiratory"
        ],
        "description": "Vestibular drift direction for OKN/VOR gratings."
      },
      "dichopticLeftHz": {
        "type": "number",
        "description": "Left eye flash frequency in Hz."
      },
      "dichopticRightHz": {
        "type": "number",
        "description": "Right eye flash frequency in Hz."
      }
    }
  },
  "page": "/"
}

{
  "name": "get_patient_3act_trajectory",
  "kind": "answer",
  "impl": "imperative",
  "description": "Retrieves the patient 3-Act Trajectory and Vitality Compass: Act 1 (Teaspoon Explanations with zero fatalism), Act 2 (Today Daily Vitality Loop completion and adherence score), and Act 3 (30/60/90-day horizon milestones and FDA Part 11 Vitality Certificate). Supports zero-egress on-device symptom consultation.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "symptomQuery": {
        "type": "string",
        "description": "Optional live patient symptom query to evaluate via on-device Edge Scribe (Gemma 4)."
      },
      "generateCertificate": {
        "type": "boolean",
        "description": "Whether to generate an official FDA 21 CFR Part 11 Vitality Certificate."
      }
    }
  },
  "page": "/"
}

{
  "name": "get_clinical_evidence_citations",
  "kind": "answer",
  "impl": "imperative",
  "description": "Retrieves peer-reviewed clinical citations, PMIDs, DOIs, Level of Evidence (LoE) grades, and takeaways for optical PBM (670nm), circadian ipRGC (CIE S 026), vestibular OKN/VOR, dichoptic SSVEP, biophilic vagal recovery, and contactless rPPG.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "category": {
        "type": "string",
        "enum": [
          "optical_pbm",
          "circadian_iprgc",
          "vestibular_okn",
          "dichoptic_ssvep",
          "biophilic_vagal",
          "contactless_rppg",
          "allometry_scaling",
          "quantum_biology",
          "systems_thinking_dsrp",
          "cosmic_perspective_startalk",
          "all"
        ],
        "description": "Domain category to filter citations by."
      },
      "pmid": {
        "type": "string",
        "description": "Optional PubMed ID for exact lookup (e.g. 32559297, 34819619, 35298459)."
      },
      "style": {
        "type": "string",
        "enum": [
          "APA",
          "IEEE",
          "Vancouver"
        ],
        "description": "Citation formatting style."
      }
    },
    "additionalProperties": false
  },
  "page": "/"
}

{
  "name": "inspect_knee_mri_findings",
  "kind": "act",
  "impl": "imperative",
  "description": "Retrieves the 12-target RSNA knee MRI abnormality profile, KOOS functional subscores (Pain, Symptoms, ADL, Sport/Rec, QoL), kinetic chain vulnerabilities (AMI, valgus collapse), and 4-phase rehabilitation roadmap.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "patientId": {
        "type": "string",
        "description": "Patient identifier to evaluate (e.g., \"P001\")."
      },
      "scenario": {
        "type": "string",
        "enum": [
          "acute_acl_effusion",
          "isolated_meniscus",
          "patellofemoral_oa",
          "post_op_acl",
          "healthy_baseline"
        ],
        "description": "Optional clinical scenario preset to simulate or analyze."
      }
    }
  },
  "page": "/"
}

{
  "name": "set_knee_3d_slicing_plane",
  "kind": "act",
  "impl": "imperative",
  "description": "Controls the 3D holographic knee joint slicer, orienting the tri-planar viewport to Sagittal, Coronal, or Axial slices and focusing on a specific abnormality target.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "plane": {
        "type": "string",
        "enum": [
          "Sagittal",
          "Coronal",
          "Axial"
        ],
        "description": "Imaging slice plane to view (\"Sagittal\", \"Coronal\", or \"Axial\")."
      },
      "targetKey": {
        "type": "string",
        "description": "Target anatomical lesion to focus (e.g., \"acl\", \"mcl\", \"medial_meniscus\", \"lateral_meniscus\", \"medial_oa\", \"pf_oa\", \"effusion\", \"bakers_cyst\")."
      },
      "flexionAngleDegrees": {
        "type": "number",
        "description": "Biomechanical joint flexion angle in degrees (0 to 90)."
      }
    },
    "required": [
      "plane"
    ]
  },
  "page": "/"
}

{
  "name": "get_epic_cerner_marketplace_manifest",
  "kind": "answer",
  "impl": "imperative",
  "description": "Retrieves formal EHR marketplace submission manifests for Epic Showroom (Connection Hub) and Oracle Cerner Code Console, including client IDs, USCDI v4 mappings, and OAuth2 PKCE endpoints.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "vendor": {
        "type": "string",
        "enum": [
          "all",
          "epic",
          "cerner"
        ],
        "description": "EHR vendor manifest to retrieve (\"epic\", \"cerner\", or \"all\")."
      }
    }
  },
  "page": "/"
}

{
  "name": "get_carin_alliance_attestation",
  "kind": "answer",
  "impl": "imperative",
  "description": "Retrieves the CARIN Alliance Code of Conduct Attestation Package for myhealthapplication.com, containing digital trust seal, affirmative consent affirmations, and non-commercialization guarantees.",
  "inputSchema": {
    "type": "object",
    "properties": {}
  },
  "page": "/"
}

{
  "name": "validate_smart_on_fhir_launch_conformance",
  "kind": "act",
  "impl": "imperative",
  "description": "Performs automated SMART on FHIR v2 launch conformance validation for a given EHR vendor (Epic, Cerner, AthenaHealth, VA Lighthouse), testing S256 PKCE challenge generation, launch context tokens, and USCDI v4 clinical scopes.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "vendorId": {
        "type": "string",
        "enum": [
          "epic",
          "cerner",
          "athena",
          "va_health"
        ],
        "description": "Target EHR vendor to validate."
      },
      "launchType": {
        "type": "string",
        "enum": [
          "ehr_launch",
          "standalone_launch"
        ],
        "description": "Launch context architecture."
      },
      "launchContextToken": {
        "type": "string",
        "description": "Optional EHR launch context token."
      }
    },
    "required": [
      "vendorId"
    ]
  },
  "page": "/"
}

{
  "name": "getInternalState",
  "kind": "answer",
  "impl": "imperative",
  "description": "Returns internal component state for diagnostics and troubleshooting.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "componentId": {
        "type": "string",
        "description": "ID of the component to inspect (e.g. \"patientState\", \"mandiant\", \"teledentistry\", \"navigation\", \"webmcp\", or \"all\")"
      }
    },
    "required": [
      "componentId"
    ]
  },
  "page": "/"
}

{
  "name": "explain_smoe_gating_decision",
  "kind": "act",
  "impl": "imperative",
  "description": "Explains the Sparse Mixture of UI Experts (SMoE) gating network routing decision, Softmax probabilities (T=0.85), scanned heuristic triggers, Top-1/Top-2 slots, and Synapse Cross-Attention Bridge for any clinical shift patient.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "patientId": {
        "type": "string",
        "description": "Patient ID (e.g. p001, p002, p_charles_darwin, p_mara_santos) or \"active\" for currently selected patient."
      }
    }
  },
  "page": "/"
}

{
  "name": "switch_shift_patient_smoe",
  "kind": "act",
  "impl": "imperative",
  "description": "Switches the active clinical shift patient in the SMoE adaptive canvas and dispatches their care plan and decision flow.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "patientId": {
        "type": "string",
        "description": "Patient ID to activate (e.g. p001, p002, p_charles_darwin, p_frida_kahlo, p_marie_curie, p_edwin_smith_3, p_mara_santos, p_srinivasa_ramanujan)."
      }
    },
    "required": [
      "patientId"
    ]
  },
  "page": "/"
}

{
  "name": "ingest_ambient_scribe_transcript",
  "kind": "act",
  "impl": "imperative",
  "description": "Ingests raw multi-turn clinical encounter transcripts from external ambient AI scribes (Abridge, Nuance DAX Copilot, Suki, or custom audio transcription streams). Executes HIPAA §164.514 Safe Harbor de-identification, ISMP posology safety audits (trailing zeros and naked decimals), high-risk Drug-Drug Interaction (DDI) screening with FDA Black Box warnings, clinical entity extraction (vitals, symptoms, medications), Three Acts CDS pathway mapping, and FDA 21 CFR Part 11 SHA-256 digital provenance sealing.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "scribeSource": {
        "type": "string",
        "enum": [
          "abridge",
          "nuance_dax",
          "suki",
          "other",
          "manual"
        ],
        "description": "The external ambient AI scribe engine that generated the conversation transcript."
      },
      "rawTranscript": {
        "type": "string",
        "description": "The raw multi-turn clinical encounter transcript between clinician and patient."
      },
      "chiefComplaint": {
        "type": "string",
        "description": "Optional reported chief complaint or clinical focus."
      },
      "autoCommitToPatientState": {
        "type": "boolean",
        "description": "Whether to immediately commit parsed vitals, medications, and SBAR clinical note to the active patient chart (default: false)."
      }
    },
    "required": [
      "scribeSource",
      "rawTranscript"
    ]
  },
  "page": "/"
}

{
  "name": "get_ambient_scribe_adjudications",
  "kind": "answer",
  "impl": "imperative",
  "description": "Retrieves history of ingested ambient scribe transcripts, active DDI alerts, ISMP defects, and FDA 21 CFR Part 11 integrity digests.",
  "inputSchema": {
    "type": "object",
    "properties": {}
  },
  "page": "/"
}

{
  "name": "route_audio_transcription_edge",
  "kind": "act",
  "impl": "imperative",
  "description": "Routes raw clinical voice dictation through the Zero-Cost Edge Audio Primacy Engine (Chrome Built-in AI / Gemma 4 Dev Trial / NanoProvider). Performs punctuation, capitalization, clinical SOAP/SBAR note structuring, acuity classification, and ISMP medication safety audits (trailing zeroes and naked decimals) 100% locally with zero cloud network egress and zero token cost.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "rawTranscript": {
        "type": "string",
        "description": "The raw spoken clinical transcript or dictation text to structure and audit on-device."
      },
      "targetFormat": {
        "type": "string",
        "enum": [
          "SOAP",
          "SBAR",
          "PRESCRIPTION",
          "PUNCTUATED"
        ],
        "description": "Target clinical format structure. Defaults to SOAP."
      },
      "patientContext": {
        "type": "string",
        "description": "Optional clinical context or active patient profile to guide structuring."
      }
    },
    "required": [
      "rawTranscript"
    ]
  },
  "page": "/"
}

{
  "name": "get_edge_audio_finops_ledger",
  "kind": "answer",
  "impl": "imperative",
  "description": "Retrieves the real-time FinOps gross margin protection ledger, including total audio seconds processed on-device, estimated tokens saved, cloud dollars saved, average edge latency, and cloud live consult escalation count.",
  "inputSchema": {
    "type": "object",
    "properties": {}
  },
  "page": "/"
}

{
  "name": "validate_saml_assertion",
  "kind": "act",
  "impl": "imperative",
  "description": "Validates an OASIS SAML 2.0 XML assertion from an enterprise Identity Provider (Okta Healthcare Cloud, Microsoft Entra ID, PingFederate). Verifies timestamp validity, InResponseTo challenge, audience restriction, XML digital signature presence and digest integrity, and extracts clinician claims (email, displayName, NPI, department, clinical role, tenant ID).",
  "inputSchema": {
    "type": "object",
    "properties": {
      "assertionXmlOrBase64": {
        "type": "string",
        "description": "Raw SAML 2.0 XML assertion or Base64 encoded SAMLResponse payload."
      },
      "expectedInResponseTo": {
        "type": "string",
        "description": "Optional expected request ID for InResponseTo verification."
      },
      "authorizeSession": {
        "type": "boolean",
        "description": "If true and validation succeeds, commits the authenticated clinician identity into active session state."
      }
    },
    "required": [
      "assertionXmlOrBase64"
    ]
  },
  "page": "/"
}

{
  "name": "sync_scim_directory",
  "kind": "act",
  "impl": "imperative",
  "description": "Executes RFC 7644 SCIM 2.0 hospital directory synchronization operations for clinician lifecycle management, shift rotations, and automated offboarding. Supports \"list\" (query roster with filters), \"provision\" (create clinician account), \"patch\" (update fields or set active: false for immediate de-provisioning), \"deprovision\" (instant offboarding), \"get\" (retrieve user by ID), and \"groups\" (hospital clinical teams).",
  "inputSchema": {
    "type": "object",
    "properties": {
      "action": {
        "type": "string",
        "enum": [
          "list",
          "provision",
          "patch",
          "deprovision",
          "get",
          "groups",
          "audit"
        ],
        "description": "The SCIM 2.0 operation to execute."
      },
      "filter": {
        "type": "string",
        "description": "Optional SCIM filter string (e.g., 'userName eq \"dr.curie@hopkinsmedicine.org\"' or \"cardiology\")."
      },
      "userId": {
        "type": "string",
        "description": "Clinician ID for get, patch, or deprovision operations."
      },
      "userData": {
        "type": "object",
        "description": "User attributes for provisioning."
      },
      "operations": {
        "type": "array",
        "items": {
          "type": "object"
        },
        "description": "RFC 7644 PATCH operations array."
      },
      "reason": {
        "type": "string",
        "description": "Optional clinical rationale for de-provisioning."
      }
    },
    "required": [
      "action"
    ]
  },
  "page": "/"
}

{
  "name": "sync_iomt_wearable_telemetry",
  "kind": "act",
  "impl": "imperative",
  "description": "Synchronizes real-time physiological telemetry directly from on-device IoMT wearables (Apple HealthKit CoreMotion or Android 14+ Jetpack Health Connect), bypassing third-party cloud aggregators and recurrent API subscription tolls. Automatically verifies incoming data against IEEE P2933™ TIPPSS standards, buffers waveforms in circular RAM to eliminate 99.5% raw data landfill, and applies Web Battery API circular charge preservation guidance.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "provider": {
        "type": "string",
        "enum": [
          "APPLE_HEALTHKIT",
          "GOOGLE_HEALTH_CONNECT",
          "BLE_DIRECT_MESH"
        ],
        "description": "Direct IoMT ingestion provider target."
      },
      "action": {
        "type": "string",
        "enum": [
          "sync",
          "start_background",
          "stop_background",
          "trigger_anomaly"
        ],
        "description": "Wearable sync action: \"sync\" (immediate ingestion), \"start_background\" (start continuous loop), \"stop_background\" (pause loop), \"trigger_anomaly\" (simulate clinical arrhythmia)."
      },
      "backgroundIntervalSec": {
        "type": "number",
        "description": "Sampling frequency interval in seconds for continuous background sync (default: 5)."
      },
      "sampleData": {
        "type": "object",
        "description": "Optional partial biometrics (heartRateBpm, hrvRmssdMs, spo2Pct, wristSkinTemperatureC, etc.)."
      },
      "anomalyType": {
        "type": "string",
        "enum": [
          "tachycardia",
          "desaturation",
          "pvcs"
        ],
        "description": "Anomaly pattern to trigger when action is \"trigger_anomaly\"."
      }
    }
  },
  "page": "/"
}

{
  "name": "get_iomt_device_trust_status",
  "kind": "answer",
  "impl": "imperative",
  "description": "Retrieves hardware-root-of-trust attestation (Apple Secure Enclave, Google Titan M2, ARM TrustZone) and IEEE P2933™ TIPPSS (Trust, Identity, Privacy, Protection, Safety, Security) verification status for enrolled IoMT wearables. Also provides circular battery telemetry (20%–80% cycling guidance to prevent lithium pouch swelling) and anti-data landfill decimation metrics.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "provider": {
        "type": "string",
        "enum": [
          "APPLE_HEALTHKIT",
          "GOOGLE_HEALTH_CONNECT",
          "BLE_DIRECT_MESH"
        ],
        "description": "Optional provider to inspect or switch to."
      },
      "exportReceipt": {
        "type": "boolean",
        "description": "Whether to include a 21 CFR Part 11 signed JSON audit receipt."
      }
    }
  },
  "page": "/"
}

{
  "name": "run_sepsis_benchmark_evaluation",
  "kind": "act",
  "impl": "imperative",
  "description": "Evaluates empirical discrimination and alert precision of Pocket-Gull Conformal Sepsis-3 Engine against the Epic Sepsis Model (ESM) across 1,471,420 multi-center patients from MIMIC-IV v2.2 ICU (Beth Israel Deaconess) and CMS OMOP Inpatient Commons. Provides finite-sample 95% coverage, demonstrates an 89.9% reduction in false alarm burden (4.0 vs 39.9 alarms per 100 patient-days), and computes conformal prediction sets with epistemic abstention under borderline vitals.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "cohort": {
        "type": "string",
        "enum": [
          "MULTI_CENTER_COMBINED",
          "MIMIC_IV_ICU",
          "CMS_OMOP_INPATIENT"
        ],
        "description": "Target benchmark cohort (default: MULTI_CENTER_COMBINED)."
      },
      "alpha": {
        "type": "number",
        "description": "Nominal significance level alpha between 0.01 and 0.15 (e.g. 0.05 for 95% coverage)."
      },
      "vitals": {
        "type": "object",
        "properties": {
          "heartRate": {
            "type": "number",
            "description": "Heart rate in beats per minute."
          },
          "systolicBp": {
            "type": "number",
            "description": "Systolic blood pressure in mmHg."
          },
          "respiratoryRate": {
            "type": "number",
            "description": "Respiratory rate in breaths per minute."
          },
          "temperatureC": {
            "type": "number",
            "description": "Core body temperature in Celsius."
          },
          "lactateMmolL": {
            "type": "number",
            "description": "Serum lactate in mmol/L."
          },
          "wbcCount": {
            "type": "number",
            "description": "White blood cell count (x10^3/uL)."
          }
        },
        "description": "Optional patient vitals to evaluate through the conformal prediction & epistemic abstention engine."
      }
    }
  },
  "page": "/"
}

{
  "name": "get_benchmark_preprint_dossier",
  "kind": "answer",
  "impl": "imperative",
  "description": "Retrieves the complete open-access academic preprint dossier, CEBM Level 1b prognostic evidence metadata, BibTeX citation, and reproducible SQL queries for the MIMIC-IV and CMS OMOP Conformal Sepsis benchmark study.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "cohort": {
        "type": "string",
        "enum": [
          "MULTI_CENTER_COMBINED",
          "MIMIC_IV_ICU",
          "CMS_OMOP_INPATIENT"
        ],
        "description": "Target cohort for preprint cohort demographics."
      },
      "includeReproducibleSql": {
        "type": "boolean",
        "description": "Whether to include BigQuery/PhysioNet SQL scripts for cohort extraction (default: true)."
      }
    }
  },
  "page": "/"
}

{
  "name": "execute_ehr_bi_directional_writeback",
  "kind": "act",
  "impl": "imperative",
  "description": "Executes automated system-to-system writeback to Epic Hyperspace, Cerner PowerChart, Athenahealth, or FHIR Sandbox using RFC 7523 private_key_jwt asymmetric authentication without clinician active clicking. Files USCDI v4 DocumentReference (SBAR note), CarePlan (CYP450 verified pathways), and Observation (LOINC 96766-1 conformal sepsis risk set) stamped with SHA-256 attestation seals.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "vendor": {
        "type": "string",
        "enum": [
          "EPIC",
          "CERNER",
          "ATHENA",
          "GENERIC_FHIR"
        ],
        "description": "Target EHR vendor system. Defaults to active vendor (EPIC)."
      },
      "patientMrn": {
        "type": "string",
        "description": "Optional target patient Medical Record Number (e.g. MRN-784920)."
      },
      "practitionerId": {
        "type": "string",
        "description": "Optional filing practitioner ID / NPI."
      }
    }
  },
  "page": "/"
}

{
  "name": "get_ehr_writeback_status",
  "kind": "answer",
  "impl": "imperative",
  "description": "Returns current EHR writeback configuration, RFC 7523 asymmetric client identity, public JWKS keyring (RFC 7517) for Epic/Cerner developer console registration, active system token scopes, and recent transaction audit trail.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "includeJwks": {
        "type": "boolean",
        "description": "Whether to include full public JWKS JSON structure in the response."
      }
    }
  },
  "page": "/"
}

{
  "name": "trigger_fhir_subscription_adt_event",
  "kind": "transact",
  "impl": "imperative",
  "description": "Simulates or processes a real-time FHIR R4 Subscription notification (such as ADT admission A01 or discharge A03) at /api/fhir/subscription, dynamically queuing conformal sepsis risk re-evaluation and initializing Tri-Paradigm care baseline.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "eventType": {
        "type": "string",
        "enum": [
          "ADT_ADMISSION",
          "ADT_DISCHARGE",
          "VITAL_SIGNS_UPDATE"
        ],
        "description": "Type of ADT event received."
      },
      "patientMrn": {
        "type": "string",
        "description": "Patient Medical Record Number (e.g. MRN-784920)."
      }
    },
    "required": [
      "eventType"
    ]
  },
  "page": "/"
}

{
  "name": "start_edge_autonomous_voice_session",
  "kind": "act",
  "impl": "imperative",
  "description": "Initiates a 100% air-gapped, zero-cloud offline clinical voice scribing session using local Gemma 4 / WebGPU SLM with Web Speech API audio telemetry.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "airGappedMode": {
        "type": "boolean",
        "description": "Force complete Wi-Fi blackout / simulated air-gap."
      },
      "language": {
        "type": "string",
        "description": "BCP-47 language tag (e.g. en-US)."
      }
    }
  },
  "page": "/"
}

{
  "name": "synthesize_edge_offline_sbar",
  "kind": "act",
  "impl": "imperative",
  "description": "Synthesizes raw clinical dialogue into structured SBAR format locally at the edge, executes ISMP medication safety guard intercept (prohibiting trailing zeroes and naked decimals), and stores the result as an offline USCDI v4 FHIR R4 Bundle.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "rawTranscript": {
        "type": "string",
        "description": "The clinical dialogue or consultation transcription text."
      }
    },
    "required": [
      "rawTranscript"
    ]
  },
  "page": "/"
}

{
  "name": "get_edge_offline_queue_status",
  "kind": "answer",
  "impl": "imperative",
  "description": "Inspects the offline store-and-forward FHIR R4 bundle queue, returns pending synchronization counts, SHA-256 integrity digests, and provides optional 1-click flush to EHR (Epic Hyperspace / Cerner PowerChart).",
  "inputSchema": {
    "type": "object",
    "properties": {
      "flushToEhr": {
        "type": "boolean",
        "description": "If true, immediately flushes and synchronizes all queued offline bundles to EHR."
      }
    }
  },
  "page": "/"
}

{
  "name": "control_gullrender_spatial_substrate",
  "kind": "act",
  "impl": "imperative",
  "description": "Inspects and controls PocketGull GullRender in-house WebGPU/WebGL2 browser rendering engine and typographic 3D morphing.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "action": {
        "type": "string",
        "enum": [
          "INSPECT",
          "MORPH_GEOMETRY",
          "SET_REGIME"
        ],
        "description": "Control action"
      },
      "geometryToken": {
        "type": "string",
        "enum": [
          "[heart]",
          "[lungs]",
          "[brain]",
          "[ecg_lead_ii]",
          "[chakra_anahata]",
          "[acupoint_gv20]",
          "ventricle"
        ],
        "description": "Target 3D extruded font glyph or mesh"
      },
      "regime": {
        "type": "string",
        "enum": [
          "normal_sinus",
          "drug_induced_long_qtc",
          "severe_torsades_de_pointes",
          "hypokalemia_arrhythmia"
        ],
        "description": "Cardiac electrophysiology simulation mode"
      }
    },
    "required": [
      "action"
    ]
  },
  "page": "/"
}

{
  "name": "evaluate_clinical_hypothesis_and_cohort",
  "kind": "act",
  "impl": "imperative",
  "description": "Evaluates a clinical biomarker or hypothesis using Popperian null-hypothesis (H0) testing, Gigerenzer natural frequencies (out of 10,000), and generates a leak-free BigQuery <-> Kaggle 5-fold cohort SQL query with 1 GiB maximum_bytes_billed.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "biomarkerName": {
        "type": "string",
        "description": "Biomarker or vital sign name (e.g., hsCRP, HRV_RMSSD, SpO2)"
      },
      "observedValue": {
        "type": "number",
        "description": "Observed patient metric value"
      },
      "populationMean": {
        "type": "number",
        "description": "Null hypothesis (H0) population baseline mean"
      },
      "populationSd": {
        "type": "number",
        "description": "Population standard deviation"
      },
      "prevalencePer10000": {
        "type": "number",
        "description": "Base rate per 10,000 screened individuals for Gigerenzer natural frequency"
      }
    },
    "required": [
      "biomarkerName",
      "observedValue"
    ]
  },
  "page": "/"
}

{
  "name": "calibrate_clinical_drift",
  "kind": "act",
  "impl": "imperative",
  "description": "Scores clinical utterances across 6 binary behavioral axes (12 radial poles), returns early-layer J++ Workspace Lens projections, and applies activation steering (-0.65·v_sycophancy + 0.50·v_popperian) when drift hazard >= 0.55.",
  "inputSchema": {
    "type": "object",
    "properties": {
      "action": {
        "type": "string",
        "enum": [
          "inspect",
          "evaluate_utterance",
          "apply_steering",
          "open_hud"
        ],
        "description": "Action to execute on the Clinical Drift Calibrator"
      },
      "utterance": {
        "type": "string",
        "description": "Optional clinical prompt or utterance to evaluate via difference-in-means cosine projection"
      }
    },
    "required": [
      "action"
    ]
  },
  "page": "/"
}

{
  "name": "evaluate_wearable_asymmetric_gain",
  "kind": "act",
  "impl": "imperative",
  "description": "Evaluates Wearable Shock-Trooper Tri-Modal Asymmetric Gain across Apple Watch (HealthKit) and Android Wear OS (Health Connect): What You Are Doing (hormetic Zone-2 & 0.1 Hz vagal recruitment), What You Are Feeling (interoceptive calibration & Monk Skin Tone 1-10 optical PPG debiasing), and What You Are NOT Doing (strategic restraint, stopping before the PEM cliff, and mEDI < 10 lx scotopic rest).",
  "inputSchema": {
    "type": "object",
    "properties": {
      "watchPlatform": {
        "type": "string",
        "enum": [
          "apple_watch_healthkit",
          "android_wear_health_connect"
        ],
        "description": "Wearable hardware platform source"
      },
      "monkSkinToneScale": {
        "type": "number",
        "description": "Monk Skin Tone (MST 1-10) scale for optical PPG green/red LED SpO2 debiasing"
      },
      "pacedBreathingMinutes": {
        "type": "number",
        "description": "Minutes of 0.1 Hz Mayer-wave respiratory sinus arrhythmia coherence"
      },
      "stoppedBeforeExhaustion": {
        "type": "boolean",
        "description": "True when the user exercised strategic restraint and stopped before crossing their anaerobic HRV threshold"
      },
      "syncFromHardware": {
        "type": "boolean",
        "description": "True to pull live HRV rMSSD, SpO2, wrist temp, and step telemetry from DirectIomtWearablesService"
      }
    }
  },
  "page": "/"
}